Loading...

Messages

Proposals

Stuck in your homework and missing deadline? Get urgent help in $10/Page with 24 hours deadline

Get Urgent Writing Help In Your Essays, Assignments, Homeworks, Dissertation, Thesis Or Coursework & Achieve A+ Grades.

Privacy Guaranteed - 100% Plagiarism Free Writing - Free Turnitin Report - Professional And Experienced Writers - 24/7 Online Support

Draw an mrna strand that is complementary

06/12/2021 Client: muhammad11 Deadline: 2 Day

Microbiology

Transcription and Translation Worksheet
DNA Template
DNA: 5’-CTCTACTATAAACTCAATAGGTCC-3’
1. Write the DNA sequence that is complementary to the DNA strand provided.

2. Label the 5’ and 3’ ends of the new DNA strand.

Transcription
1. Draw a box around the sequence where RNA polymerase will bind to the DNA.

2. What is this sequence called?

3. Will transcription start at this sequence, to the left of this sequence (“upstream”) or, to the right of this sequence (“downstream”)? Draw a small arrow above the DNA strand where transcription will begin.

4. Which DNA strand will RNA polymerase transcribe? Highlight this strand with your highlighter. (Hint: RNA pol is similar to DNA pol because it can only make new RNA in the 5’ to 3’ direction.

5. Draw in an arrow to show the direction that RNA polymerase will move along the DNA strand.

6. RNA polymerase builds a molecule made out of RNA nucleotides rather than DNA nucleotides. How is an RNA nucleotide different from a DNA nucleotide?

7. Write the sequence of the RNA molecule that will be transcribed.

8. Label the 5’ and 3’ end.

9. Where will RNA polymerase stop transcribing?

10. After transcription, eukaryotes process the pre-mRNA molecule.

11. Explain the difference between introns and exons.

12. Consider the following RNA sequence:

5’-cap-ACCCAGUUCAUGCCCGUGGCAUGUCGUGCCCAGU-polyA tail-3’

13. Introns are the following sequence: “GUUCA” and “UGGC” and “CCCA”

14. Write the sequence after the mRNA has been processed

Transcription
mRNA: 5’ – UGAUCAUGAUCUCGUAAGAUAUC – 3’

1. Draw a box around the sequence where protein synthesis will begin. What is this sequence called? Does an amino acid get inserted at this site? If so, which one?

2. Draw in an arrow to show the direction that a ribosome will move along the mRNA strand.

3. From the starting point, mark off the codons, and identify the correct amino acid that will be inserted at that codon.

4. Draw a second box around the sequence where protein synthesis will stop. What is this sequence called?

5. Label the N-terminus and C-terminus of the polypeptide (amino acid) chain.

Homework is Completed By:

Writer Writer Name Amount Client Comments & Rating
Instant Homework Helper

ONLINE

Instant Homework Helper

$36

She helped me in last minute in a very reasonable price. She is a lifesaver, I got A+ grade in my homework, I will surely hire her again for my next assignments, Thumbs Up!

Order & Get This Solution Within 3 Hours in $25/Page

Custom Original Solution And Get A+ Grades

  • 100% Plagiarism Free
  • Proper APA/MLA/Harvard Referencing
  • Delivery in 3 Hours After Placing Order
  • Free Turnitin Report
  • Unlimited Revisions
  • Privacy Guaranteed

Order & Get This Solution Within 6 Hours in $20/Page

Custom Original Solution And Get A+ Grades

  • 100% Plagiarism Free
  • Proper APA/MLA/Harvard Referencing
  • Delivery in 6 Hours After Placing Order
  • Free Turnitin Report
  • Unlimited Revisions
  • Privacy Guaranteed

Order & Get This Solution Within 12 Hours in $15/Page

Custom Original Solution And Get A+ Grades

  • 100% Plagiarism Free
  • Proper APA/MLA/Harvard Referencing
  • Delivery in 12 Hours After Placing Order
  • Free Turnitin Report
  • Unlimited Revisions
  • Privacy Guaranteed

6 writers have sent their proposals to do this homework:

Pro Writer
Quick N Quality
Engineering Guru
Maths Master
Write My Coursework
Financial Assignments
Writer Writer Name Offer Chat
Pro Writer

ONLINE

Pro Writer

I am a PhD writer with 10 years of experience. I will be delivering high-quality, plagiarism-free work to you in the minimum amount of time. Waiting for your message.

$39 Chat With Writer
Quick N Quality

ONLINE

Quick N Quality

I am an experienced researcher here with master education. After reading your posting, I feel, you need an expert research writer to complete your project.Thank You

$47 Chat With Writer
Engineering Guru

ONLINE

Engineering Guru

I will provide you with the well organized and well research papers from different primary and secondary sources will write the content that will support your points.

$17 Chat With Writer
Maths Master

ONLINE

Maths Master

I will provide you with the well organized and well research papers from different primary and secondary sources will write the content that will support your points.

$20 Chat With Writer
Write My Coursework

ONLINE

Write My Coursework

I will provide you with the well organized and well research papers from different primary and secondary sources will write the content that will support your points.

$15 Chat With Writer
Financial Assignments

ONLINE

Financial Assignments

I have read your project description carefully and you will get plagiarism free writing according to your requirements. Thank You

$25 Chat With Writer

Let our expert academic writers to help you in achieving a+ grades in your homework, assignment, quiz or exam.

Similar Homework Questions

Building regulations ireland stairs - A consumer's need for reinforcement is - How to make a fuse with potassium nitrate - Quality improvement cycle nursing wa - Statistical inference casella berger solutions - Inclined plane experiment variables - Chcece003 assessment answer - Activity 13.3 nisqually glacier response to climate change answers - Hclo strong or weak electrolyte - Electronic product design engineering - Gibbs reflective cycle academic writing - Explain two principles of competent effective interpersonal communications - Map of the great wall of china - Willington hall riding school - Interpretation project 2 bibl 110 - We've all been there analysis - Describe the situation at lehman brothers from an ethics perspective - Patient education on medication safety - Caroline bowen phonetic development - Comparison of presidential healthcare agendas - Interior design fee proposal letter - Case Study - Work-9 - Square root transformation formula - First Steps on Becoming a Grassroots Lobbyist/Advocate for Health Care Policy - Angola prison documentary netflix - What is the primacy effect psychology - Snopes quit bashing obama's accomplishments - Describe the methods used to diagnose a pheochromocytoma - Clipsal 9w led downlight - Verb groups and phrases - Tonight i can write the saddest lines analysis - Global City Discussion BUTLER/LEES or SIVAM - Two tuning forks with frequencies of - Trireme labeled diagram - Prolexic proxy - Amex hungary case study answers - The very noisy bear literacy activities - St martin guide to writing 8th edition pdf - 2016 maps clip art by bruce jones design inc - Business Valuation - Why does ice float - Ken is traveling for his business - Sam patch the famous jumper summary of chapters - Walden Pathophysiology Knowledge Check - Cat on a hot tin roof full text - Gear - Parker and stone inc is looking - I need an rhetorical analysis on an article - Benchmark - Collaboration and Communication Action Plan - Advantages of non renewable energy sources - Main roads western australia specifications - Formulas and oxidation numbers lab answers - Financial reporting loftus 2nd edition - Who is the antagonist in the glass menagerie - Science Essay (Quality Work, On Time, A++ work) - Harry wong's effective classroom management model - Henry assael consumer behavior model with example - Health Care Managaement paper - English 101 Essay 3 PG about - How to present nmr data - Paper post -- 600 words, APA format, at least 3 references - Report - Unknown project microbiology lab report - Hap baker range carroll county landfill - Pan europa foods sa case study answers - The language of trust maslansky pdf - Draw an angle with the given measure in standard position - 5 levels of leadership assessment - Victor victoria nonverbal cues - Organizes and codes patient records gathers statistical data - 1 what features of contemporary e commerce does groupon utilize - Yoga posture reflection - Trial balance with adjustments problems - Houston independent school district - Supply and demand of nike shoes - Family tree maker companion guide - Wet cooling tower diagram - Reference circle in shm - Stranger child abduction cases - Project management case study wbs - Black Leather Trucker: Slim or Relaxed Fit? - Vancouver xsl file download - Http outlook com live ucl ac uk - Ca skill assessment application form - What is tenant ledger - Auditing - Example of a dietary analysis - Performance compensation and rewards presentation - X bar chart minitab - Case study - Mother any distance annotations - Major service with accompanying minor goods and services - Togaf solution architecture template - Terror management theory documentary - Are crunches aerobic or anaerobic - Types of invasion games - As3000 current carrying capacity table - What does it mean to develop a sociological imagination - Advantages and disadvantages of transactional model of communication