Draw an mrna strand that is complementary

Microbiology

Transcription and Translation Worksheet
DNA Template
DNA: 5’-CTCTACTATAAACTCAATAGGTCC-3’
1. Write the DNA sequence that is complementary to the DNA strand provided.

2. Label the 5’ and 3’ ends of the new DNA strand.

Transcription
1. Draw a box around the sequence where RNA polymerase will bind to the DNA.

2. What is this sequence called?

3. Will transcription start at this sequence, to the left of this sequence (“upstream”) or, to the right of this sequence (“downstream”)? Draw a small arrow above the DNA strand where transcription will begin.

4. Which DNA strand will RNA polymerase transcribe? Highlight this strand with your highlighter. (Hint: RNA pol is similar to DNA pol because it can only make new RNA in the 5’ to 3’ direction.

5. Draw in an arrow to show the direction that RNA polymerase will move along the DNA strand.

6. RNA polymerase builds a molecule made out of RNA nucleotides rather than DNA nucleotides. How is an RNA nucleotide different from a DNA nucleotide?

7. Write the sequence of the RNA molecule that will be transcribed.

8. Label the 5’ and 3’ end.

9. Where will RNA polymerase stop transcribing?

10. After transcription, eukaryotes process the pre-mRNA molecule.

11. Explain the difference between introns and exons.

12. Consider the following RNA sequence:

5’-cap-ACCCAGUUCAUGCCCGUGGCAUGUCGUGCCCAGU-polyA tail-3’

13. Introns are the following sequence: “GUUCA” and “UGGC” and “CCCA”

14. Write the sequence after the mRNA has been processed

Transcription
mRNA: 5’ – UGAUCAUGAUCUCGUAAGAUAUC – 3’

1. Draw a box around the sequence where protein synthesis will begin. What is this sequence called? Does an amino acid get inserted at this site? If so, which one?

2. Draw in an arrow to show the direction that a ribosome will move along the mRNA strand.

3. From the starting point, mark off the codons, and identify the correct amino acid that will be inserted at that codon.

4. Draw a second box around the sequence where protein synthesis will stop. What is this sequence called?

5. Label the N-terminus and C-terminus of the polypeptide (amino acid) chain.